fastautil
TypeScript icon, indicating that this package has built-in type declarations

1.1.1 • Public • Published

fastautil

Build Status

Auxillary Fasta parser utils for working with fasta object.just Read and parse.

Install

Install fastautil with npm:

$ npm install fastautil

Usage

Reading

var fastautil = require('fastautil');
 
fasta== new fastautil.Fasta();
 
var object = fasta.parse('>sequence1\n\
ATGCACGTCACGTCAGTACTCGTCAGTAC\n\
>sequence2\n\
CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC\n');
 
//=>   { 
//   id:1,
//    name: 'sequence1',
//       sequence: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
//     { 
//        name: 'sequence2',
//       sequence: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }

Writing

 
fasta.write(object);
 

Contributing

To contribute, clone this repo locally and commit your code on a separate branch.

Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:

$ npm test

Check the issues for ways to contribute.

Contacts

Sahil Shetye <sahilshetye2606@gmail.com> @sahilshetye

Package Sidebar

Install

npm i fastautil

Weekly Downloads

3

Version

1.1.1

License

ISC

Last publish

Collaborators

  • sshetye