
0.1.5 • Public • Published


paired-end NGS simulator



npm install pairgen 


command line

$ pairgen [options] <fasta file> [<ranges bed file>]

  --name  name of the sequence. default = basename(path)
  --readlen length of the read. default = 100
  --tlen  length of the template. default = 400
  --dev standard deviation of the total fragment length. default = 50
  --depth physical read depth. default = 40
  --save_dir  directory to save result. default = /home/shinout/node_modules/pairgen
  --pair_id <id_type> pair id type, put pair information explicitly. id_type is one of A, 1, F, F3.
  --parallel  the number of processes to run. default: 1
  --p5  Illumina P5 adapter. default: GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
  --p7  Illumina P7 adapter. default: ACACTCTTTCCCTACACGACGCTCTTCCGATCT




npm i pairgen

Downloadsweekly downloads









last publish


  • avatar
Report a vulnerability