Neatly Positioned Magazines

    fasta2json

    0.1.1 • Public • Published

    Release notes v0.1.1

    fasta2json

    Converts fasta file/string to a json object.

    NPM Version NPM Downloads

    Installation

    You can install fasta2json using NPM or Bower:

    • npm: npm install fasta2json
    • Bower: bower install fasta2json

    Reference

    fasta2json.ReadFasta(path)

    Read a FASTA file and returns and JSON object.

    var json = fasta2json.ReadFasta('file.fasta');
    

    fasta2json.ParseFasta(string)

    Returns a JSON object from a string containing a fasta file.

    //Fasta in string format
    var fasta_str = '>seq1\nACCTAAGCTTAGCCAAAGTCCAGAACCACAGT';
    
    //Get the JSON
    var json = fasta2json.ParseFasta(fasta_str);
    
    /* Output:
    json = [{ "head": "seq1", "seq": "ACCTAAGCTTAGCCAAAGTCCAGAACCACAGT"} ] 
    */
    
    

    fasta2json.Export(json)

    Returns a string with the fasta format from an JSON object.

    //JSON object
    var json = [
    { "head": "seq1", "seq": "ACCTAAGCTTAGCCAAAGTCCAGAACCACAGT"}
    { "head": "seq2", "seq": "AACTTTGGTTAAACACATGGATCCAGTTTGAC"}
    ];
    
    //Get a string
    var string = fasta2json.Export(json);
    
    /* Output:
    string = '>seq1\nACCTAAGCTTAGCCAAAGTCCAGAACCACAGT\n>seq2\nAACTTTGGTTAAACACATGGATCCAGTTTGAC\n'
    */
    

    fasta2json.ExportToFile(json, file)

    Generates a fasta file from the json object.

    fasta2json.ExportToFile(json, 'new.fasta');
    

    License

    fasta2json is under the MIT license.

    Install

    npm i fasta2json

    DownloadsWeekly Downloads

    5

    Version

    0.1.1

    License

    MIT

    Last publish

    Collaborators

    • jmjuanes