drptranslator
TypeScript icon, indicating that this package has built-in type declarations

2.8.0 • Public • Published

Build Status

NOTICE

  • Since version 1.2.0 This library requires you to use node 6+

Hello everyone!

Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you!

DRPTranslator is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :)

At the moment these are some of the usages of the principal uses:

  • Translate a DNA sequence into a RNA sequence
  • Obtain the complementary DNA sequence from another DNA sequence
  • Translate directly from DNA to an Aminoacid sequence
  • Translate RNA to an Aminoacid sequence
  • Find starts and stops codons in a sequence

and some other cool stuff like a obtaining a codon array or find the first and last start and stop sequence.

Install

how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency

npm install --save drptranslator

Usage

Tou can Test it Here Javascript

const { RNATranslator, DNATranslator } = require("drptranslator");
 
const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
 
console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

Typescript

import { RNATranslator, DNATranslator }  from "drptranslator";
 
const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
 
console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

What's next?

  • Document source files
  • Creating a website for its API docs
  • Publish a demo of an app using the library
  • Adding more cappabilities

Suggestions

If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!

Package Sidebar

Install

npm i drptranslator

Weekly Downloads

4

Version

2.8.0

License

MIT

Unpacked Size

68 kB

Total Files

33

Last publish

Collaborators

  • tunaxor