Newbie Paintball Master

    drptranslator
    TypeScript icon, indicating that this package has built-in type declarations

    2.8.0 • Public • Published

    Build Status

    NOTICE

    • Since version 1.2.0 This library requires you to use node 6+

    Hello everyone!

    Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you!

    DRPTranslator is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :)

    At the moment these are some of the usages of the principal uses:

    • Translate a DNA sequence into a RNA sequence
    • Obtain the complementary DNA sequence from another DNA sequence
    • Translate directly from DNA to an Aminoacid sequence
    • Translate RNA to an Aminoacid sequence
    • Find starts and stops codons in a sequence

    and some other cool stuff like a obtaining a codon array or find the first and last start and stop sequence.

    Install

    how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency

    npm install --save drptranslator

    Usage

    Tou can Test it Here Javascript

    const { RNATranslator, DNATranslator } = require("drptranslator");
     
    const rTranslator = new RNATranslator();
    const dTranslator = new DNATranslator();
    const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
    const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
    const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
    const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
    const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
     
    console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
    // "Met-Val-Cys"
    // "Tyr-Gln-Thr"
    // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
    // "GGCTAGCTAGCGCTAGCTAGAACGAGT"
    // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

    Typescript

    import { RNATranslator, DNATranslator }  from "drptranslator";
     
    const rTranslator = new RNATranslator();
    const dTranslator = new DNATranslator();
    const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
    const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
    const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
    const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
    const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
     
    console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
    // "Met-Val-Cys"
    // "Tyr-Gln-Thr"
    // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
    // "GGCTAGCTAGCGCTAGCTAGAACGAGT"
    // "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"

    What's next?

    • Document source files
    • Creating a website for its API docs
    • Publish a demo of an app using the library
    • Adding more cappabilities

    Suggestions

    If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!

    Install

    npm i drptranslator

    DownloadsWeekly Downloads

    5

    Version

    2.8.0

    License

    MIT

    Unpacked Size

    68 kB

    Total Files

    33

    Last publish

    Collaborators

    • tunaxor