blast-wrapper

wrapper for pairwise BLAST

blast-wrapper

blast-wrapper is a node.js web-service wrapper for fetching pairwise BLAST or BLAST+ alignments against a fixed reference.

In theory this should be faster than a CGI wrapper.

I use this for aligning sequences to the mitochondrial genome.

A mitochondrial BLAST index and sample config files are provided.

git clone git@github.com:leipzig/blast-wrapper.git
cd blast-wrapper
npm start
npm install blast-wrapper
npm blast-wrapper start

http://localhost:8080/?name=mysequence&seq=TGGTCAACCTCGACCTAGGCCTCCTATTTATTCTAGCCACCG

BLASTN 2.2.28+
 
 
Query= mysequence
 
Length=42
 
Subject= gi|251831106|ref|NC_012920.1| Homo sapiens mitochondrion, complete
genome
 
Length=16569
 
 
 Score = 70.4 bits (35),  Expect = 4e-16
 Identities = 40/41 (98%), Gaps = 0/41 (0%)
 Strand=Plus/Plus
 
Query  1     TGGTCAACCTCGACCTAGGCCTCCTATTTATTCTAGCCACC  41
             ||||||||||| |||||||||||||||||||||||||||||
Sbjct  3590  TGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACC  3630
 
 
 
Lambda      K        H
    1.39    0.747     1.38 
 
Gapped
Lambda      K        H
    1.39    0.747     1.38 
 
Effective search space used: 546480
 
 
 
 
Matrix: blastn matrix 1 -5
Gap Penalties: Existence: 5, Extension: 3