bionode-fasta

0.5.6 • Public • Published

bionode logo
bionode.io

# bionode-fasta > Streamable FASTA parser.

NPM version Build Status Coveralls Status Dependency Status Gitter chat DOI

Install

Install bionode-fasta with npm:

$ npm install bionode-fasta

To use it as a command line tool, you can install it globally by adding -g .

Alternatively, just include bionode-fasta.min.js via a <script/> in your page.

Usage

If you are using bionode-fasta with Node.js, you can require the module:

var fasta = require('bionode-fasta')
 
fasta('./input.fasta').pipe(process.stdout) // Returns Buffers
fasta.obj('./input.fasta').on('data', console.log) // Returns Objects
fs.createReadStream('./input.fasta').pipe(fasta()) // Parses streamed content
fs.createReadStream('./fasta-list.txt')
.pipe(split())
.pipe(fasta({filenameMode: true})) // Parses files from filename Strings
 
=>   { id: 'sequence1',
       seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
     { id: 'sequence2',
       seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }
 
fasta.obj({includePath: true}, './input.fasta').on('data', console.log) // Returns Objects
=>   { id: 'sequence1',
       seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC'
       path: './input.fasta' }

Please read the documentation for the methods exposed by bionode-fasta.

Command line example

$ bionode-fasta input.fasta output.json

Contributing

To contribute, clone this repo locally and commit your code on a separate branch.

Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:

$ npm test

Please also check for code coverage:

$ npm run coverage

To rebuild and minify the module for the browser:

$ npm run build-browser

To rebuild the documentation using the comments in the code:

$ npm run build-docs

Check the issues for ways to contribute.

Contacts

Bruno Vieira <mail@bmpvieira.com> @bmpvieira

License

bionode-fasta is licensed under the MIT license.
Check ChooseALicense.com for details.

Bitdeli Badge

Package Sidebar

Install

npm i bionode-fasta

Homepage

bionode.io

Weekly Downloads

8

Version

0.5.6

License

MIT

Last publish

Collaborators

  • bmpvieira
  • maxogden
  • mafintosh