
    8.3.20 • Public • Published

    Bio Parsers

    About this Repo

    This repo contains a set of parsers to convert between datatypes through a generalized JSON format.


    Exported Functions

    Use the following exports to convert to a generalized JSON format:

    fastaToJson //handles fasta files (.fa, .fasta)
    genbankToJson //handles genbank files (.gb, .gbk)
    ab1ToJson //handles .ab1 sequencing read files 
    sbolXmlToJson //handles .sbol files
    snapgeneToJson //handles snapgene (.dna) files
    anyToJson    //this handles any of the above file types based on file extension

    Use the following exports to convert from a generalized JSON format back to a specific format:


    Format Specification

    The generalized JSON format looks like:

    const generalizedJsonFormat = {
        "size": 25,
        "sequence": "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
        "circular": true,
        "name": "pBbS8c-RFP",
        "description": "",
        "chromatogramData": { //only if parsing in an ab1 file
          "aTrace": [], //same as cTrace but for a
          "tTrace": [], //same as cTrace but for t
          "gTrace": [], //same as cTrace but for g
          "cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
          "basePos": [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced)
          "baseCalls": ["A", "T", ...etc],
          "qualNums": [], //or undefined if no qualNums are detected on the file
        "features": [
                "name": "anonymous feature",
                "type": "misc_feature",
                "id": "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
                "start": 1,
                "end": 3,
                "strand": 1,
                "notes": {},
                "name": "coding region 1",
                "type": "CDS",
                "id": "5590c1d88979df000a4f02f5",
                "start": 12,
                "end": 9,
                "strand": -1,
                "notes": {},



    npm install -S bio-parsers


    yarn add bio-parsers


    use it from a script tag:

    <script src=""></script>
          async function main() {
            var jsonOutput = await window.bioParsers.genbankToJson(
              `LOCUS       kc2         108 bp    DNA     linear    01-NOV-2016
    COMMENT             teselagen_unique_id: 581929a7bc6d3e00ac7394e8
    FEATURES             Location/Qualifiers
         CDS             1..108
         misc_feature    61..108
         bogus_dude      4..60
         misc_feature    4..60
            1 atgaaggtct acggcaagga acagtttttg cggatgcgcc agagcatgtt ccccgatcgc
           61 ggtggcagtg gtagcgggag ctcgggtggc tcaggctctg ggg
            console.log('jsonOutput:', jsonOutput);
            var genbankString = window.bioParsers.jsonToGenbank(jsonOutput[0].parsedSequence);

    see the ./umd_demo.html file for a full working example

    jsonToGenbank (same interface as jsonToFasta)

    //To go from json to genbank:
    import { jsonToGenbank } from "bio-parsers"
    //You can pass an optional options object as the second argument. Here are the defaults
    const options = {
      isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true)
      guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag)
      guessIfProteinOptions: {
        threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA
        dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA 
      inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive 
      inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive 
      // Example:
      // 0123456
      // ATGAGAG
      // --fff--  (the feature covers GAG)
      // 0-based inclusive start:
      // feature.start = 2
      // 1-based inclusive start:
      // feature.start = 3
      // 0-based inclusive end:
      // feature.end = 4
      // 1-based inclusive end:
      // feature.end = 5
    const genbankString = jsonToGenbank(generalizedJsonFormat, options)

    anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)

    import { anyToJson } from "bio-parsers"
    //note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed)
    const results = await anyToJson(
      stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs
      options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
    //we always return an array of results because some files my contain multiple sequences 
    results[0].success //either true or false 
    results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
    results[0].parsedSequence //this will be the generalized json format as specified above :)
    //chromatogram data will be here (ab1 only): 

    Options (for anyToJson or xxxxToJson)

    //You can pass an optional options object as the third argument. Here are the defaults
    const options = {
      fileName: "", //the filename is used if none is found in the genbank           
      isProtein: false, //if you know that it is a protein string being parsed you can pass true here
      parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true 
      //genbankToJson options only
      inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive 
      inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive 
      acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the array. Setting this to false will keep them as features instead


    import { ab1ToJson } from "bio-parsers"
    const results = await ab1ToJson(
      //this can be either a browser file  <input type="file" id="input" multiple onchange="ab1ToJson(this.files[0])">
      // or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
      options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
    //we always return an array of results because some files my contain multiple sequences 
    results[0].success //either true or false 
    results[0].messages //either an array of strings giving any warnings or errors generated during the parsing process
    results[0].parsedSequence //this will be the generalized json format as specified above :)
    //chromatogram data will be here (ab1 only): 

    snapgeneToJson (.dna files)

    import { snapgeneToJson } from "bio-parsers"
    //file can be either a browser file  <input type="file" id="input" multiple onchange="snapgeneToJson(this.files[0])">
    // or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
    const results = await snapgeneToJson(file,options)


    import { genbankToJson } from "bio-parsers"
    const result = genbankToJson(string, options)
    // [
    //     {
    //         "messages": [
    //             "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
    //             "Invalid feature end:  1384 detected for Homo sapiens and set to 1",
    //         ],
    //         "success": true,
    //         "parsedSequence": {
    //             "features": [
    //                 {
    //                     "notes": {
    //                         "organism": [
    //                             "Homo sapiens"
    //                         ],
    //                         "db_xref": [
    //                             "taxon:9606"
    //                         ],
    //                         "chromosome": [
    //                             "17"
    //                         ],
    //                         "map": [
    //                             "17q21"
    //                         ]
    //                     },
    //                     "type": "source",
    //                     "strand": 1,
    //                     "name": "Homo sapiens",
    //                     "start": 0,
    //                     "end": 1
    //                 }
    //             ],
    //             "name": "NP_003623",
    //             "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
    //             "circular": true,
    //             "extraLines": [
    //                 "DEFINITION  contactin-associated protein 1 precursor [Homo sapiens].",
    //                 "ACCESSION   NP_003623",
    //                 "VERSION     NP_003623.1  GI:4505463",
    //                 "DBSOURCE    REFSEQ: accession NM_003632.2",
    //                 "KEYWORDS    RefSeq."
    //             ],
    //             "type": "DNA",
    //             "size": 925
    //         }
    //     }
    // ]

    You can see more examples by looking at the tests.

    Editing This Repo

    All collaborators:

    Edit/create a new file and update/add any relevant tests. Make sure they pass by running yarn test


    yarn test-debug

    Updating this repo

    Teselagen collaborators

    Commit and push all changes Sign into npm using the teselagen npm account (npm whoami)

    npm version patch|minor|major
    npm publish

    Outside collaborators

    fork and pull request please :)



    npm i bio-parsers

    DownloadsWeekly Downloads






    Unpacked Size

    5.1 MB

    Total Files


    Last publish


    • teselagen-admin
    • tnrich