Neolithic Prancing Minotaurs

    @mmsb/result_page
    TypeScript icon, indicating that this package has built-in type declarations

    3.4.0 • Public • Published

    Built With Stencil

    Table of sgRNA with radial representation

    example display

    Usage

    Need property to launch integrated components. So need complete_data to create the table-crispr component to the left side and alL_data, org_names and potentially gene to create genomic-card component.

    If the gene property is given, then the linear-card component is created when the user click on a sector on the sunburst.

    complete_data

    A list of dictionary object in JSON format. Each dictionary has two keys : sequence and occurences. Occurences contains a list of dictionary object with org and all_ref as keys. all_ref contains a list of dictionary object with ref and coords keys which contains a list of coordinates. Coordinate must match the regex : [+-]\([0-9]*,[0-9]*\)

    [
        {
            "sequence": "AAAACTCAAATGAATTGACGGGG",
            "occurences": [
                {
                    "org": "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1",
                    "all_ref": [
                        {
                            "ref": "NC_015662.1",
                            "coords": [
                                "-(195725,195747)"
                            ]
                        }
                    ]
                },
                {
                    "org": "Aliivibrio wodanis GCF_000953695.1",
                    "all_ref": [
                        {
                            "ref": "NZ_LN554846.1",
                            "coords": [
                                "+(2675080,2675102)",
                                "+(2862314,2862336)",
                                "+(2959996,2960018)",
                                "-(507284,507306)",
                                "-(559657,559679)",
                                "-(661047,661069)"
                            ]
                        },
                        {
                            "ref": "NZ_LN554847.1",
                            "coords": [
                                "+(894485,894507)"
                            ]
                        }
                    ]
                }
            ]
        }
    ]

    all_data

    A dictionary of organisms selected in JSON format with their referencesn sgRNA on them and their coordinates which must match the regex : [+-]\([0-9]*,[0-9]*\)

    {
      "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1":
      {"NC_015662.1":
        {"AAAACTCAAATGAATTGACGGGG":
          ["-(195725,195747)"],
        "AAACTCAAATGAATTGACGGGGG":
          ["-(195726,195748)"],
        "TCCCCACTGCTGCCTCCCGTAGG":
          ["+(506719,506741)", "+(559092,559114)", "+(660482,660504)", "-(2675645,2675667)", "-(2862879,2862901)", "-(2960561,2960583)"]
        }
      },
      "Aliivibrio wodanis GCF_000953695.1":
        {"NZ_LN554846.1":
          {"AAAACTCAAATGAATTGACGGGG":
            ["+(2675080,2675102)", "+(2862314,2862336)", "+(2959996,2960018)", "-(507284,507306)", "-(559657,559679)", "-(661047,661069)"]
          },
        "NZ_LN554847.1":
          {"AAAACTCAAATGAATTGACGGGG":
            ["+(894485,894507)"]
          }
        }
    }

    org_names

    A string of organisms names selected seperated by "&".

    "Enterobacter sp. 638 GCF_000016325.1&Candidatus Blochmannia vafer str. BVAF GCF_000185985.2"
    

    size

    If no precise, all size are set to 4,518,734.

    {
      "Enterobacter sp. 638 GCF_000016325.1":
        {"NC_009436.1":100000},
      "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
        {"NC_014909.2": 2000000}}

    gene

    A dictionary object with organisms as keys and their references. Then, a list of dictionary with start and end keys to indicate coordinates of gene.

    {
      "Enterobacter sp. 638 GCF_000016325.1":
        {"NC_009436.1":
          [{"start": "255180", "end": "255599"}, {"start": "842680", "end": "843099"}, {"start": "3343077", "end": "3343496"}, {"start": "4024310", "end": "4024729"}, {"start": "4269724", "end": "4270143"}, {"start": "4360796", "end": "4361215"}, {"start": "4466539", "end": "4466958"}]
        },
      "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
        {"NC_014909.2":
          [{"start": "626246", "end": "626664"}]
        }
    }

    Event

    ***** GENOMIC-CARD *****

    Emit

    • changeOrgCard : sent the name of the organism selected

    • changeRefCard : sent the reference selected

    • changeSgrnaCard : sent the sgRNA selected

    • sgDataSection : sent : allSgrna --> dictionary of sgRNA with their coordinates in a list
      gene --> a list of dictionary containing start and stop for genes

    Send

    • changeOrgCard : change the organism selected, find data associated to this organism and create a new representation

    • changeRefCard : change the reference selected, find data associated and create a new representation

    • changeSgrnaCard : represent sgRNA selected by a red vertical line around the circle

    • changeOrgRefSgrna : find name of the organism name and its reference in axis key and sgRNA selected in sgrna key. Find data associated and create a new representation

    Authors

    Sophie LEMATRE

    Date

    July 22 2019

    Keywords

    none

    Install

    npm i @mmsb/result_page

    DownloadsWeekly Downloads

    2

    Version

    3.4.0

    License

    MIT

    Unpacked Size

    1.93 MB

    Total Files

    93

    Last publish

    Collaborators

    • alkihis
    • sophielem
    • glaunay
    • cecilpert