@mmsb/genomic-card
    TypeScript icon, indicating that this package has built-in type declarations

    3.3.0 • Public • Published

    Built With Stencil

    Genomic card

    example display

    Usage

    Need three mandatory properties and one optional. The optional is the gene property. If it's present, when you click on a section an event is emmitted with coordinates of gene and sgRNA inside this section. Moreover, if you click on section, only sgRNA inside this section can be selected and others section become grey.

    The script clusteringTree allow to create a clustering tree to display the sunburst.

    min: position minimal
    max: position maximal
    children: array of children
    weight: number of sgRNA
    niv: number level to display sunburst
    

    all_data

    A dictionary of organisms selected in JSON format with their referencesn sgRNA on them and their coordinates which must match the regex : [+-]\([0-9]*,[0-9]*\)

    {
      "Buchnera aphidicola (Cinara tujafilina) GCF_000217635.1":
      {"NC_015662.1":
        {"AAAACTCAAATGAATTGACGGGG":
          ["-(195725,195747)"],
        "AAACTCAAATGAATTGACGGGGG":
          ["-(195726,195748)"],
        "TCCCCACTGCTGCCTCCCGTAGG":
          ["+(506719,506741)", "+(559092,559114)", "+(660482,660504)", "-(2675645,2675667)", "-(2862879,2862901)", "-(2960561,2960583)"]
        }
      },
      "Aliivibrio wodanis GCF_000953695.1":
        {"NZ_LN554846.1":
          {"AAAACTCAAATGAATTGACGGGG":
            ["+(2675080,2675102)", "+(2862314,2862336)", "+(2959996,2960018)", "-(507284,507306)", "-(559657,559679)", "-(661047,661069)"]
          },
        "NZ_LN554847.1":
          {"AAAACTCAAATGAATTGACGGGG":
            ["+(894485,894507)"]
          }
        }
    }

    org_names

    A string of organisms names selected seperated by "&".

    "Enterobacter sp. 638 GCF_000016325.1&Candidatus Blochmannia vafer str. BVAF GCF_000185985.2"
    

    gene

    A dictionary object with organisms as keys and their references. Then, a list of dictionary with start and end keys to indicate coordinates of gene.

    {
      "Enterobacter sp. 638 GCF_000016325.1":
        {"NC_009436.1":
          [{"start": "255180", "end": "255599"}, {"start": "842680", "end": "843099"}, {"start": "3343077", "end": "3343496"}, {"start": "4024310", "end": "4024729"}, {"start": "4269724", "end": "4270143"}, {"start": "4360796", "end": "4361215"}, {"start": "4466539", "end": "4466958"}]
        },
      "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
        {"NC_014909.2":
          [{"start": "626246", "end": "626664"}]
        }
    }

    diagonal_svg

    The pixel number of the svg.

    size

    If no precise, all size are set to 4,518,734.

    {
      "Enterobacter sp. 638 GCF_000016325.1":
        {"NC_009436.1":100000},
      "Candidatus Blochmannia vafer str. BVAF GCF_000185985.2":
        {"NC_014909.2": 2000000}}

    Event

    Emit

    • changeOrgCard : sent the name of the organism selected

    • changeRefCard : sent the reference selected

    • changeSgrnaCard : sent the sgRNA selected

    • sgDataSection : sent : allSgrna --> dictionary of sgRNA with their coordinates in a list
      gene --> a list of dictionary containing start and stop for genes

    Send

    • changeOrgCard : change the organism selected, find data associated to this organism and create a new representation

    • changeRefCard : change the reference selected, find data associated and create a new representation

    • changeSgrnaCard : represent sgRNA selected by a red vertical line around the circle

    • changeOrgRefSgrna : find name of the organism name and its reference in axis key and sgRNA selected in sgrna key. Find data associated and create a new representation

    Authors

    Sophie LEMATRE

    Date

    July 18 2019

    Keywords

    none

    Install

    npm i @mmsb/genomic-card

    DownloadsWeekly Downloads

    0

    Version

    3.3.0

    License

    MIT

    Unpacked Size

    1.44 MB

    Total Files

    75

    Last publish

    Collaborators

    • alkihis
    • cecilpert
    • glaunay
    • sophielem